Nature of Water
BIO 115 ONLINE BLOCK 4 TAKE-HOME TEST Water 1.Describe the polar nature of water. Describe the structural features of the molecule that make it polar. 2.What is hydrogen bonding in water? How does this relate to surface tension that exists in a glass of water? 3.Why did the first organisms that appeared on earth need to remain underwater? Why couldn’t they live on land? 4.Describe: -the process of biochemical synthesis -why is it sometimes called dehydration? -the process of biochemical hydrolysis Introduction to biomolecules 5.What are the 4 major categories of biomolecules found in living systems? Proteins 6.Proteins are made of ___________________ strung together 7.Draw a generic amino acid 8.How are different amino acids structurally different from one another? 9.Proteins have 4 levels of structural organization. What are they? 10.Amino acids in a protein are connected together by _______________ bonds 11.What level of protein organization is represented below? 12.What are the 2 most common secondary structures found in proteins? -draw each below 13.Draw a protein that has secondary structures within it and a tertiary structure. Label the secondary structure(s) and indicate the tertiary structure. 14.Draw a protein with quaternary structure. 15.What happens when a protein is denatured and what things can denature it? 16.Do all amino acids possess the same number of carbons? 17.Many proteins are enzymes. What do enzymes do in biochemical systems? 18.What is an enzyme’s active site? What happens there? 19.What nonprotein molecules often work with enzymes and from where are they derived? CARBOHYDRATES 20.All (or at least most) carbohydrate names have what suffix? It is: 21.What is the derivation of the term carbohydrate? What are the name’s component parts? 22.Carbohydrates have a category/group called the monosaccharides. -draw a monosaccharide below -why are they called monosaccharides? 23.Draw a monosaccharide in its haworth projection below 24.Name ________________ monosaccharides -2 significant pentose-2 significant hexose 25.Monosaccharides are linked together to form a disaccharide. How is this linkage formed? 26.Draw an alpha disaccharide linkage bond and a beta disaccharide linkage bond. -what is the biological significance of these 2 linkages? 27.Name 3 significant disaccharides 28.What population of humans worldwide is the most lactose tolerant? 29.What causes lactose intolerance? 30.What is the difference between a monosaccharide, a disaccharide, and a polysaccharide? 31.How are starch, cellulose and glycogen similar? -how are they different? -what is the function of each? -starch-cellulose-glycogen 32.If mammals cannot break beta polysaccharide linkages, how is it possible for them to obtain calories from the cellulose that they eat? 33.Where do you find chitin in nature? -is it a mono-, di-, or polysaccharide? LIPIDS 34.Draw a saturated fatty acid with 12 carbon atoms here 35.What is the difference between a saturated and unsaturated fatty acid -draw an unsaturated fatty acid below 36.Draw a cis-unsaturated fatty acid and a trans-unsaturated fatty acid below. Make a note of the structural differences between the two. 37.Draw a triacylglyceride below and label it’s component parts 38.What is the difference between a fat and an oil? What do they have in common? 39.Draw a picture of a phospholipid. Label the hydrophobic and the hydrophilic portions 40.Phospholipids are a common component of the cell _______________________ 41.The other class of lipids is the steroids. Why do you think they are classified as lipids? 42.What are examples of steroid-like lipids presented in class? DNA – General 43.Nucleic acids are made of long strings of nucleotides. Draw a nucleotide and label its 3 components. 44.What are the 4 nucleotides found in: -DNA – -RNA – 45.What are 3 differences between DNA molecules and RNA molecules? 46.This is a 1/2 of a strand of DNA: AATCTGCGTCTGTCAGTTCGT What is the 2nd. complementary strand? 47.The nucleotide strands in the DNA molecule are antiparallel. What does this mean? 48.Why do they call DNA a double helix? 49.Draw the new and improved, updated Central Dogma Theory of DNA and RNA function and interactions below– DNA – Part 2 50.What is transcription and where does it occur in a cell? 51.The following 1/2 strand of DNA needs to be transcribed. It will be used to make a protein. AATCTGCGTCTGTCAGTTCGT -what is the resultant mRNA molecule that will be produced? -how many codons does the mRNA strand contain? 52.After transcription in the nucleus, the mRNA travels to the cytoplasm to be used to make a protein by translation. The following nucleic acid structures participate in translation-what are their names and their functions? -tRNA – -rRNA – mRNA – 53.What is the composition and structure of a ribosome and what role does it play in translation? 54.The following is a double strand of DNA to be used to make a protein: ATGATTCGCTCAATCGGA – sense strand TACTAAGCGAGTTAGCCT -the sense strand will be transcribed -here is the sense strand sequence divided into codons: ATG ATT CGC TCA ATC GGA ____ ____ ____ ____ ____ _____ -write the corresponds sequence in the mRNA ____ ____ ____ ____ ____ _____ -write the matching anticodon sequences of tRNA -how many amino acids will be connected to make the corresponding protein? 55.Briefly describe the step by step process of translation The cell membrane 56.Illustrate the Fluid Mosaic Model of the typical cell membrane and label its components 57.Why do they call it: -fluid -mosaic 58.Define osmosis 59.Define the process of: -diffusion across a membrane -facilitated transport across a cell membrane -active transport across a cell membrane 60.Define: -exocytosis -endocytosis Cell structure and organelles 61.What is the difference between a prokaryotic and a eukaryotic cell? 62.What is apoptosis? Under what conditions does it occur?
Our experts will write you a top-quality paper and revise it an unlimited number of times until you're 100% satisfied - or offer a refund.
